Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YB09FM1
Length(NT) : 714
Best Gene Model Blast : Link to GSTUMT00008447001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: chitin synthase
Accession: emb|CAB41410.1| Score: 1102 E_value: 1e-118
KEGG Definition: chitin synthase D
Accession: ani:AN1555.2 Score: 786 E_value: 2e-82
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P78611|CHSD_EMENI
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0004100 = Molecular function: chitin synthase activity

Sequence:
>SY0AAB4YB09FM1
TTGGAGAAACAGGATGATGCTGTTCGCCCGCCTTCTCTGTGGAACGTTTA
CTGCGCAATCATCACCTTCTGGTGTCCAGGTGCACTTTTGAAGTGCTTCG
GTAAGCCTGCCAAAGCGCAACAACGAGCGTGGAGAGAGAAAATGGGTCTC
ATCAGTATCATTCTTCTCATTTGCGCGTTCGTCGGCTTCCTTACCTTCGG
TTTTACACAATCGGTTTGCGGAGATCCTATTCAACGCTTAAAGGTCAATC
AGGTTGGCACTGGATACTTGATCATGCACGGACGAGCCTACGATCTCACA
GGGTCCAAACATCCAGCTACTGTTGATTTCCCCGTTAATAGCAACGTTCT
ATACGATCTTCCCGAGAAGAACGGCGGGAAGGATGCATCATTCTTGTTTC
AGAACGTCAATGGCCAGTGCAAGGGGTTGATCACTCCTTCCGAAAAATCG
ACGATACCCACCGATTCCAGCGGTGGAATGGCTTGGTATTTCCCTTGCAG
GGTTTTCAATCAGGATGGGTCCACAAAGCCGAACTTGAACATGACCGATC
AGAAATATCTCGGGTACGCCTGCCACACCAGCGGTGCCGCAAGACAAGAT
TTTTACAGGCTCAAAGGTGCCACCGAAGTTTACTTCTCATGGAACGACAT
CAAAAACAGCTCTAGAAACCTTCTGGTCTATTCGAGTAGTGTGTTGGATC
TTGACCTTCTCAAT

Sequences in the Contig:

SY0AAB4YB09FM1