Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YO05FM1
Length(NT) : 557
Best Gene Model Blast : Link to GSTUMT00009762001 E-value : 1e-147
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 290 E_value: 3e-27
PFAM Definition: No Hit Found

Sequence:
>SY0AAB49YO05FM1
TTGGCTCCCCGACCAGCCCTGACTACTCCCCTACTAGCCCTGCCTTCAGT
GGTGGGGTTGGTAACAGTCATTCTCCAACTTCGCCGACCAGTCCCAACTA
TAGTCCTACAAGCCCTGTCTATTCTCCTGGCAGTCCCGCTGCTAGCTATA
GCCCGACAAGTCCAACCTTCCAGAGTCCCACTCAGGGGAGTCCGAGGTGG
TCGCCGACAAGCCCCGGGCCAAGCTATTCACCAACATCCCCTAGAGACCC
CCCGAGGAATTCTTAATAAGGGGGCTAGATTTCTGATTCCGAAAATAATT
CTTACATGAAATGGCTTTTTTTAAAAAGTTTTCCTTTTTTGCTTCAAGTT
TTTTGTTTTTGCATGGGGTAAAACGGATTCTACAGCTTTTTCCTTTCATT
TCCTTTTTCTTTTTCGTGATTGATTGATGTTTTACTCTTCTCGGAGGTCC
GGACATTTGTTCAGAGGAGTCGTGTTTCTGTAGGCAGGGGTTTCTAGTTG
GGGTGGTTAGTGGCAAAGTCAAGGATTGATGATGAGAGAGAGCCATGCCT
ATCGGCT

Sequences in the Contig:

SY0AAB49YO05FM1