Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YN21FM1
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00011260001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat protein, putative
Accession: ref|XP_001315129.1| Score: 159 E_value: 2e-09
KEGG Definition: ankyrin repeat protein, putative
Accession: tva:TVAG_169080 Score: 159 E_value: 1e-09
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 147 E_value: 1e-10
PFAM Definition: No Hit Found
Swissprot: Q9SQK3|EM506_ARATH

Sequence:
>SY0AAB49YN21FM1
TTGGACTACACCTACAAGCAATCAAATACCCAAAATGCCTTCGCGACAGG
ACTTCCCCCTCCTCTCCCTCCTAAACGAACTCATCGTCGCGGTCGCCTAA
CAACTCATGGAGATCGCCGACCTTCACTCCTTGCTGCTGACAAACAAGAG
ACTATCTATGCTCCTGCCGACAATCCTGCACATGCACGCCGCGAATTCTA
CCCTCTCGCTACCAGCGCTCTACTGGGCAATCTCCACGGGCGACGAACCT
ATGACTACGTTCCTGCTACAAAAGTCTGCTCAAGTCCTCTCAATCCGCAC
ACCGTCCCACACGCTCTTACACAGAACCCCGCATCCCTGCCCCGAAAAAA
CCCTCTCGCTCATCCTCGCGCATAGGGGAGCGATACAGGTCGAGGAGGAC
GCAACAGGTCGCACACCCCAGCACTTCGCCTGCAAGTACGCGCGGCCCAA
GCTGCTCTCTCGCATATTGGCCTTTGGCGCAGCGGTGGAGGCAACAGACC
ATGAGGGCTGGACACCGCTGCACGTTTCGGTCATATCGCGGCGCGAGGAC
CAGGCGTGTACGCGAGTGCTGCTCGCCCACGGCGCGGACCTATTGGCGCG
GGAGCACACCTGGCTGCAGCGCACGCCGTTGCACTCTGCGACGA

Sequences in the Contig:

SY0AAB49YN21FM1