Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YN09FM1
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00011011001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An13g01240
Accession: ref|XP_001396263.1| Score: 522 E_value: 1e-51
KEGG Definition: hypothetical protein
Accession: ang:An13g01240 Score: 522 E_value: 6e-52
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1952 Score: 483 E_value: 1e-49
PFAM Definition: No Hit Found
Swissprot: O74853|YQ93_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>SY0AAB49YN09FM1
TTGGAGCGGGGTTTGCCCAAGGACTGTCCCCATGCTTGCGATCTTCAATG
TCATGCTGGACCGTGCCCCCCTTGTCCTGCGATGGGACCTAGACAACCTT
GCCATTGCGGCAGAGATGAAGTACAGAAGCGCTGTATTGACACAGTTTAT
GAAGGTGGTTGGAGCTGTGGGCACGCCTGTGGGGACAGTTTGCCATGTGG
CAAGCATTCCTGTCCAAAACCATGCCACCCTGGGGTCTGTGGCGATTGCC
AAATACCGGAGATGCTTAAGTGCTTCTGTGGAAATAACACCAAAGGAATC
AAGTGCAGTGACAAACAGGAGCCGGTCGAGAGTACGATCAGCGATATTCA
TGGTGTCGAAAGTTGGTTGGGTTACTGGAACTGCCACTCACCATGCAATA
GGTATTTTGACTGCGGTAAACATACTTGTCAGAAGCCTTGCCATCCTCAA
GATGCGCTCCCCGCCCGCTGCCCTCGCTCGCCAGACCTTGTCACTCATTG
CCCATGTGGTAGGACCAAGATAAGTGAAATTCTTGAATCGCCTAGAGCCA
GTTGCGAGGCAGACGTCCCATCATGTG

Sequences in the Contig:

SY0AAB49YN09FM1