Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YM19FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00008503001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00900
Accession: ref|XP_001247129.1| Score: 169 E_value: 1e-10
KEGG Definition: involucrin repeat protein
Accession: afm:AFUA_2G08060 Score: 150 E_value: 1e-08
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 142 E_value: 5e-10
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 133 E_value: 6e-09

Sequence:
>SY0AAB49YM19FM1
TTGGGCAAATTGTGGACCTCGAGAACAGACTCCAGGCCCTAGCAACTGAG
AATACAGACCTTACGCACGACAAGGCGAATGTCGAGAAGAGCCTTAATGA
AGCCATCGCCCGTGGGAAGAGTGAGGCGAAAGCGTTGAACCTTGATCTTG
AGGAGAAGAAAGCATTGTTGGAAGAGAAGGATAGTCAGATTGAAGAGCTG
CAGAGGAAGATCGAGTGGTATCGGACGGAAGTCACAAGGTTAAGTCAGAC
GAACGATTCCCTGAACCAGACGAATACTGCCCTCTCGACGAGCTACAAGT
TGAGCTACGCCGCGCTCAAGGCCAAGTACGATAGGAAGCAGGAGGCCATG
CTCAAACTCTCGGACGAGCACTTGGAGCTTCAGCGCAACTTCACGGAGAT
GCAGACGGGCATGGAATCTATCATCCGCACCGAGTTATCCGAGAAGGACG
CCGAACTTGAGCGCCTGCGCGTTGAACTGGAACGGGCTAGGGAGGAAGTG
CGAAAGTTGCAGAACAAGCTCTCCGCGCGGCAGACAAACAAGTACGTTGA
CACCAAGGACATCGCGTACTTCAACTCCTCCTGCAAGAATATTTTCCAGT
CGGTCAAGATCTTCTGCAAGCAGTTCTCGTCCTTCTCCACCGGGAA

Sequences in the Contig:

SY0AAB49YM19FM1