Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YM16FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00003411001 E-value : 1e-160
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05425
Accession: ref|XP_001593997.1| Score: 203 E_value: 1e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g457 Score: 183 E_value: 1e-23
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2777 Score: 129 E_value: 1e-08
PFAM Definition: No Hit Found
Swissprot: O42912|TAD1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB49YM16FM1
TTGGGTTGCCTCCGCAGTCCTTTCGGCATATGTTGATCTTCCAAATAAAA
GTAAGCCACTAGGAAGAGGCGGTATCAACGAATGGGTTCCATTATCCGGC
ATTGTGCTCGAGTGCGGTGAAGGTACTAGTCGGCTTACCGCTGTTGCACT
AGGAACTGGCATGAAGTGTCTTCCCAAGGATAAAATCCCATTTGCTGGTG
GAATGGTTTTGCATGATAGCCATGCTGAGAGTTTGTTTATCATGCGATAA
GAAATTTTTCATGGCTGACTACCAAACAGTGCTTGCCATCAGAGGGCTTA
ATTGCTTCTTGTTGGAAGAATGCCAATCTCTGTCAGCAGATAGGTTATTT
GTATCAAAGTTCATCCGCCGAAGAAGTCAACAAGAGATTTCTCAGCAGTC
TCCTCAACCATTCACTCTGCGAGAGAGTGTTCTGATACATTTCTATTCTT
CTGAGGCTCCTTGCGGAGACGCCAGTATGGAACTAACAATGGCGGTACAG
GACGACCCAACACCATGGACCATCCTCCCACTCGCACCTGCCTCCTCTAC
CTCTCCACGCGCC

Sequences in the Contig:

SY0AAB49YM16FM1