Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YK20FM1
Length(NT) : 475
Best Gene Model Blast : Link to GSTUMT00010789001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG02784.1
Accession: ref|XP_382960.1| Score: 161 E_value: 5e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG02784.1 Score: 161 E_value: 3e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB49YK20FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGCTCCACCCAACACC
CCAGCAAGCCTACCTAACTCTCCTCCGTGCCGCACGCCTCGCCTTCGCGA
GCGACACGCAAACACTGACAGCAGCGCGTGCCAAGATCCGCCAGAAATTC
CGGCACACGCCCGCGGCGCAACGGGACCAGGGTGTGCGCTTGGCGCTGGA
AGCAGCCGAGATTTTGAGGAGGAATGTGGTTCAGGGGGTCATGAAGGAAG
GGGAGGGGATTTTTCGCTTGAGGATACATGATGAGATTGAGAAGGGGGAT
AATGCAAGTGTCAAGTTTGGTGGTGGGCGGGATGGGGGGAAGTGTTGCTC
CCGGTGAGGGGGATTGTATCATATCTTAAGGGGCGCGGGCGGGAATCGGA
TGTAAAAAAGCGGGTTGGGATTATG

Sequences in the Contig:

SY0AAB49YK20FM1