Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YK11FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00003782001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65008.1| Score: 458 E_value: 3e-44
KEGG Definition: UDP-glucose:glycoprotein glucosyltransferase [EC:2.4.1.-]; K00754
Accession: aor:AO090011000515 Score: 458 E_value: 2e-44
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1879 Score: 238 E_value: 3e-21
PFAM Definition: No Hit Found
Swissprot: Q09140|UGGG_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0003980 = Molecular function: UDP-glucose:glycoprotein glucosyltransferase activity
GO:0006950 = Biological process: response to stress

Sequence:
>SY0AAB49YK11FM1
TTGGGTCCAACTACTGTCCCACCAGATACTCGCCAGTTCTAAGCAGGATG
AGGTTCCGCAGAGGTTCGACTATCGTGATAATATCGAGGGCGGAAAGACC
ATCGTTTGGCTAAATGATTTAGAAAAAGACTTGCGATATCGAGAATGGTC
TGCCGCAGTTGATACGCTTCTTCGTCGTGTCTACCCCGGACAGTTGCATC
CCCTCCGGCGCAATGTGCACCATCTTGTTGTTCCCGTAGACCTTGCCTCT
AAGGACGATCTGGCTTTGATCACCGAGCAGTTGCGTTTGTTTGTCGATAG
GAAGATTGCTCTCCGATTTGGAGTAGTGCCTTTGACCGGGACCCCTGAAG
CTGTTGCGCAGGCAAAGGTCTTCTATTACTTGAATGAGACTTATGGCCTT
CCGGTTGCTTTGGGATATCTTGAATTGGCGCTTGGATCCGGCCAATTCTC
AAAGCCAAATGCTAAAGTCTTGGATCAAGTTATCAAAGAGGCTGAGCTCA
TTGAGGGTCGGATCGCACTGTCTTTGGAGGAGGTACTGTCCTCCGAGACT
ATCGAAGAGCGTATTAAAACGTCTAAATCATGGG

Sequences in the Contig:

SY0AAB49YK11FM1