Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YJ11FM1
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00001680001 E-value : 4e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10823
Accession: ref|XP_001550350.1| Score: 203 E_value: 9e-15
KEGG Definition: hypothetical protein ( (AF364817) NADPH oxidase 1 [Podospora anserina] )
Accession: ncr:NCU02110.1 Score: 188 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB49YJ11FM1
ATCATACATCACTGGATTGGAGGGGACATTAAGGACAAACGTCGGTGTAT
ACTTCTGCGGGCCTAGCGTTGCAGCAAGAAGTATCCGGAAGGCTTGCGTA
AAAGCTTCAACACCAGAAGTTAACTTTGGCTTCTGGAAGGAACACTTCTA
AATCGATATTGCCATCTCCTCCGACAAATCTCCTCCTGATCTGTTTTTCT
ATATCTCTGATTTGCATGTTGGTGTTGCTGCTACTGCAGAGGAAGAATTC
CCTTTATTTCCCAAGAATCCTCATGGATGATAAGCATAAATAGTTGAGCG
CTGTCTGGTGTTGTATTTTTTTTTTTTTTAGTACTGTTGTTGAGGTGATT
ATGCTGGTTCTTTGAATATCTTATGACACTCTCTTCATTTTCTCATTCTT
CTGCACTGTGTTAGTCACGGCATCTCGGGCGACTCCGAGATGGATATTAT
TTTATTCCCTGAATAAGTTCATGTAATTAGTAACTTTGATACCCAGACAC
TCTGCCCATTATGGGGGATTTTAT

Sequences in the Contig:

SY0AAB49YJ11FM1