Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YI04FM1
Length(NT) : 500
Best Gene Model Blast : Link to GSTUMT00003340001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_01678
Accession: ref|XP_001597484.1| Score: 715 E_value: 3e-74
KEGG Definition: hypothetical protein [EC:3.2.1.84]; K05546 alpha 1,3-glucosidase
Accession: mgr:MGG_08623 Score: 661 E_value: 3e-68
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1066 Score: 735 E_value: 6e-79
PFAM Definition: Glyco_hydro_31, Glycosyl hydrolases family 31. Glycosyl hydrolases are key enzymes of carbohydrate metabolism. Family 31 comprises of enzymes that are, or similar to, alpha- galactosidases..
Pfam Number: pfam01055 Score: 614 E_value: 7e-65
Swissprot: P38138|GLU2A_YEAST
Gene Ontology:
GO:0017177 = Cellular component: alpha-glucosidase II complex
GO:0005788 = Cellular component: endoplasmic reticulum lumen
GO:0005739 = Cellular component: mitochondrion
GO:0004558 = Molecular function: alpha-glucosidase activity
GO:0005515 = Molecular function: protein binding
GO:0009272 = Biological process: fungal-type cell wall biogenesis

Sequence:
>SY0AAB49YI04FM1
TTGGCCACAACATCAACGGAATGTCTTTCCATAATGCGACATACGAAGGC
TTAAAGATCAGATTGGGCAGTGGGAAGGAGAGAAGGCCCTTTGTTCTTAC
CAGGAGCTTCTTCGCTGGAAGCCAACGGAGCGCTGCTATGTGGACTGGTG
ACAATCAGGCCGACTGGCCTCATTTGCAACAGGCGTTCCCAATGCTGTTG
GCCAACGGTATCGCTGGATTCCCTTTTGCTGGAGCCGATGTCGGAGGTTT
CTTTGGCAACCCATCTAAAGAGCTTTTGACCAGGTGGTATCAGGCCGGAG
CTTTCTACCCGTTCTTCCGTGGCCATGCCCACATCGACGCCAAGCGAAGA
GAGCCGTATCTTGCAGGTGAACCATACGTCTCAATCATCAGAGATGCTAT
CCGTCTTAGGTACTCTCTCCTTCCCGCCTGGTATACCGCCTTCCACCAAG
CGAGCCGGGAAGGCATGCCGATCCTCCGACCCCATTTTGTCATGTTTCCT

Sequences in the Contig:

SY0AAB49YI04FM1