Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YH18FM1
Length(NT) : 460
Best Gene Model Blast : Link to GSTUMT00001082001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00996
Accession: ref|XP_001247225.1| Score: 205 E_value: 4e-15
KEGG Definition: small nucleolar ribonucleoprotein complex subunit, putative
Accession: afm:AFUA_2G05930 Score: 201 E_value: 5e-15
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2055 Score: 202 E_value: 3e-17
PFAM Definition: No Hit Found
Swissprot: P78750|UTP18_SCHPO

Sequence:
>SY0AAB49YH18FM1
TTGGGCTTGATACCTAAAGGAGAAGGGGAATGAGAGGTCTACCAAACTAC
CACCATTACTATTCCCATCCGCCAGCCTCACTATCGTCAACTTCCCCGGC
CGCAACCTCCCTGGAACTGTACGTGTCCAATTCGTAGTGCTCCTTAGGAT
CTCCTCGAGACTAGGCGCAGATCTCAATGCTTCCTGCTCTCCATCTTCTT
CCTCCACCCCTACCCCGTCCATCTCTTCATCGCTACTCCCCGCACCTACA
CCATGCAACCTCGCCTTCTTCCTAACCGAATCACTAACAGCCCAGTCAGG
CACGTGATAGATCCTCTCGAACTGCCTGCGCAGCCGCACAGAATACTCCT
TCCCGCTGATGAGGTCTTCAGTCTCGGTATCCCGAAGCTTACGTAGCAAG
CCCCGATTGGCAAGTGAGATGGTGAGCATTTCGTCATCAGAGTCTTGCCA
TGCTGGAAGA

Sequences in the Contig:

SY0AAB49YH18FM1