Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YH17FM1
Length(NT) : 466
Best Gene Model Blast : Link to GSTUMT00006536001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_04148
Accession: ref|XP_001594341.1| Score: 333 E_value: 6e-30
KEGG Definition: hypothetical protein
Accession: ang:An02g11720 Score: 315 E_value: 3e-28
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4342 Score: 182 E_value: 8e-15
PFAM Definition: Glyco_hydro_38C, Glycosyl hydrolases family 38 C-terminal domain. Glycosyl hydrolases are key enzymes of carbohydrate metabolism..
Pfam Number: pfam07748 Score: 138 E_value: 8e-10
Swissprot: P22855|MAN1_YEAST
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane
GO:0005515 = Molecular function: protein binding
GO:0009313 = Biological process: oligosaccharide catabolic process

Sequence:
>SY0AAB49YH17FM1
TTGGCCCGCACCACGGGCCAGTGGGAGAAACCACCGTTCGAACAGCCATG
GCTTTCAACAACCCGCTAGAACCGGGCCATGTTTCAGCCAACGAAATGGA
GAACGTGAGAGAGCTTTTAGAGACCATTAGAGTCGAAGGAGGGAGTAAGA
GCATAGTCCTGGACACCGTCAAGAGGGGCGAGGATGACGAGGACGTTTCC
ACCGGTGGGATTCCAACTAGGAAGGGACGGAGTCTGGTGCTTAGGTTTTA
TGACAGTCTTGGTGGGAAGGGGTCTACCACTGTCCATACGAGATTACTCG
TCAAGGCGGTTTATAAGACTAATGTCCTCGAGGACGATATCTCGGAGGTT
GCTCTGGCTGAGACTGCAACGGGACACAAATGCTTTAAAATTATGCTGAG
ACCTTTTGAGGTTGCGACGTATAGGTTGCAGCTTTAGGCGCTGCGGGGGA
CGGTTGTGTATCGTGC

Sequences in the Contig:

SY0AAB49YH17FM1