Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YH14FM1
Length(NT) : 526
Best Gene Model Blast : Link to GSTUMT00004497001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU06425
Accession: ref|XP_957316.1| Score: 273 E_value: 7e-23
KEGG Definition: hypothetical protein
Accession: ncr:NCU06425.1 Score: 273 E_value: 4e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB49YH14FM1
GACTCAAAACTCAACTTGATACCCGCTATTTTTTCTACAGCCACAACCTC
TCGATAAAGAGTCATAGCGTTGTACCCAACCAACCGGATCCCGTCTCCCC
AAACTGATTCCCCCCCCAATTCCCGCATCACTACTACAAATACAATGACT
TCCTACTACCCTTCGCACCATTCCCCACATTCACCTCAACCTTTACGATT
GCGACAGAGTTCGGAAAAGATGAGCATCACACAAACATTTTATCTCGCCC
ACAAGGCCCGAGGCAAGCTCTCATCGGAGGCTTCACGACAAGACCACAAC
TTGCGTCTGCTAGTTGGGCACGCAAACCTTCTGGACACATTAATGATCCA
CTTGTCCGAGGCGGAGAGGGATCAAGAAAGGTGGTTCAACGCCGTGGTTC
AAGGAAACGAAGAGTCGCGAGAATACCGAGATCTACCAGAGACAATCGAG
GAGGAGCCAGAGGAGTATGGATCGTTGGCAGCAGATTACGATTCGGATTC
AGACTCGAGCGAAGAATCAGGCGACG

Sequences in the Contig:

SY0AAB49YH14FM1