Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YE20FM1
Length(NT) : 438
Best Gene Model Blast : Link to GSTUMT00004387001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_11466
Accession: ref|XP_001550258.1| Score: 379 E_value: 3e-35
KEGG Definition: unnamed protein product
Accession: kla:KLLA0A10549g Score: 332 E_value: 4e-30
KOG Definition:
Classification: [Energy production and conversion, General function prediction only].
Kog Number: KOG1197 Score: 311 E_value: 7e-30
PFAM Definition: No Hit Found
Swissprot: P38230|QOR_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0017091 = Molecular function: AU-rich element binding
GO:0003960 = Molecular function: NADPH:quinone reductase activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>SY0AAB49YE20FM1
TTGGGATACTTTTGATGGTGACTTGGAAGTTGTGAGGAGGAAAGGGACAG
TAGTTTCTCTGGGGAACGCTAGTGGGGCTGTTCCACCATTCACAATTGCA
AGGCTAGCGCCCAAGAACCTTAAGCTTCTGAGGCCACAATTGTTTGGCTA
TATCGCCGAGAGAGGGGAATTCGAGGCTTATTCTAAGGAAGTTTTCGATT
GGATCGTTGAAGGCAAGGTTAAGGTCAATGTCCACAAGACCTACCCGCTT
GAAGAGGTCGCGCAGGCGCAAAAGGACCTTGAGTCTCGCACCACTACCGG
GAAATTGATTTTAAAGATTTGAGAAGGAAATTTTATCTCGAAGCTGTTGA
TGAATGCGGGTATCAGATATTCAGAGTCGAGTGATGGATTGTGTAACTAG
TGATATTCTATCCCGAATATAGTAAACAGCTCCACTGG

Sequences in the Contig:

SY0AAB49YE20FM1