Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB49YD03FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00005632001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63848.1| Score: 337 E_value: 3e-30
KEGG Definition: predicted protein
Accession: aor:AO090020000705 Score: 337 E_value: 2e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q8AV19|CI021_FUGRU

Sequence:
>SY0AAB49YD03FM1
TTGGATTTGTCCTCAGTCCAGATGAGTTCACCACAGTCAGATCCGCATCC
GTCCGACGCAGAACTGGCCGAAGCAGCAGCTTTCCAGGTCTTTGACAAAG
ATGGAACTTCCTACCCCTTTTCGAGTTTGTATGAAGGCGAGGGGACAGTA
GCGATTGTGTTTATCAGACACTTTTTCTGTGGGAGTTGCCAAGATTACCT
TCGAGCTCTATCAAACCCGCCGATAATTCCCCCTGATACCCCCGGGAAGA
AATTGATTATTGTTGGGCAGGGGGATCCTGCCGTGATCAAGACTTACACC
GCAGAAACCGGATGCGTGTTCCCTATCTATACGGAGCCTACTGGAGGTTT
ATACACTCTCTTTGGTATGATAAAGAATTTGAAGCTAGGAGAGAAACCGG
AGTACATTCAGCAGAGCGTAATTAGCAGTATAGCCACCAGCTTTGTTTCG
GCTCTTAAATGGGGGGGCAGAAAAGGAGGTGATTACCAGCAGAACGGCGG
AGAATGGATGTGGGAGAATGGGAAGCTGGTTTGGTGCCACCGGAT

Sequences in the Contig:

SY0AAB49YD03FM1