Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YP02FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00011758001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: emb|CAD70396.1| Score: 354 E_value: 2e-53
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02510 Score: 340 E_value: 7e-52
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3272 Score: 326 E_value: 2e-31
PFAM Definition: DUF814, Domain of unknown function (DUF814). This domain occurs in proteins that have been annotated as Fibronectin/fibrinogen binding protein by similarity. This annotation comes from Bacillus subtilis YloA, where the N-terminal region is involved in this activity. Hence the activity of this C-terminal domain is unknown. This domain contains a conserved motif D/E-X-W/Y-X-H that may be functionally important..
Pfam Number: pfam05670 Score: 168 E_value: 4e-13
Swissprot: Q7T312|CCD25_DANRE

Sequence:
>SY0AAB48YP02FM1
TTGGCTCATTTCATACCAAAAAAAGCGCATTTCCTCATTCCGCAAATCCT
TAGAATCTCGAAGAGGGCTCCAGTGCCATCATGGTTTACTACTTCACCTC
TAATATTGTAGATCCTCCAGCATTCATCTATGTCGGCAAAGACAAAGTCG
AGAATGAGGAGTTGATCAAGTATGGGTTCAAGGAAGATATATGGTTTCAC
GCAGACAATCTCTCATCGGCACACATATACCTTCGCCTCCCGGAAGGCAG
CGACTGGGAGAATATTCCACAGGACCTCCTAACCGATTGTACACAGCTCA
CAAAAGCCAACTCCATTGAAGGTTTGAAACAAGAAGGATAACGTCAATGT
TGTCTACACCCCCTGGTCAAACCTCAAGAAAGATGGTAGCATGGCCGTCG
GACAAGTTGGATTCAAAGACCAACGCAAAGTAAAAAAGATTCTGGTCGAG
ACCCGAACCAACGCCATCGTCAACCGGCTGAATAAGACGAAAGAGGAGCG
GTTCCCAGACCTAGCAGAGGAGAAGGAGGAGCGGGAACGGGAAATTCGGA
ACCAGGAGAAGAAGGCGATGCTTGAGCGGAAAAAAG

Sequences in the Contig:

SY0AAB48YP02FM1