Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YO05FM1
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00004354001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_14111
Accession: ref|XP_001585014.1| Score: 644 E_value: 9e-66
KEGG Definition: NAD-dependent aldehyde dehydrogenases
Accession: aor:AO090012000264 Score: 597 E_value: 1e-60
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2450 Score: 220 E_value: 4e-19
PFAM Definition: Aldedh, Aldehyde dehydrogenase family. This family of dehydrogenases act on aldehyde substrates. Members use NADP as a cofactor. The family includes the following members: The prototypical members are the aldehyde dehydrogenases EC:1.2.1.3. Succinate-semialdehyde dehydrogenase EC:1.2.1.16. Lactaldehyde dehydrogenase EC:1.2.1.22. Benzaldehyde dehydrogenase EC:1.2.1.28. Methylmalonate-semialdehyde dehydrogenase EC:1.2.1.27. Glyceraldehyde-3-phosphate dehydrogenase EC:1.2.1.9. Delta-1-pyrroline-5-carboxylate dehydrogenase EC: 1.5.1.12. Acetaldehyde dehydrogenase EC:1.2.1.10. Glutamate-5-semialdehyde dehydrogenase EC:1.2.1.41. This family also includes omega crystallin, an eye lens protein from squid and octopus that has little aldehyde dehydrogenase activity..
Pfam Number: pfam00171 Score: 356 E_value: 8e-35
Swissprot: Q55585|GABD_SYNY3
Gene Ontology:
GO:0009013 = Molecular function: succinate-semialdehyde dehydrogenase [NAD(P)+] activity

Sequence:
>SY0AAB48YO05FM1
TTGGCCACAATCTCTCCTATAACCGGCCAGCCATTGCTGATCCGAGAGGG
AGTCTCAGCCGAAGAGTTCCCGTCGATAGTCGAGAAATCCAATCATGCCT
TCTCGACTTTTCGTCATACCCATCCCCTGAAGAAGCGGCAGGAGATCGTC
AGGAAAGCTTTAGAGATCCTATCCAGCAAGAGCGATCTCTTAGCTAAGGA
ATTGACAGAGCAAATGGGGAGACCTATCGCTTACACTGGCTCGGAGGTGT
CGACTGCAAAGATGAGGGCAGAATACCTCTTGAAGGTTTCCGATGAGGCT
TTGAAGGATTCCCCCGGTGAAGAGCAGGAGGGGTTCAGAAGATTCATCCG
AAAGGAGCCTTTGGGAGTGATCTTGGTAATCTTCGCTTGGAACTACCCGT
ACCTTATTTTGATAAACTCGCTTGTCCCAGCCATCCTAGCTGGGAACACC
CTACTCCTGAAACCGTCCCCACAAACACCCACAGTAGCGGAACACATTGT
CTCGATATTCAGCGCAGCAGGCCTCCCAGAGAACGTATTACAGACAGTTC
ACTGTGGAAACCCTAAGGCGCTCGAGTATTTTGTTTCTCA

Sequences in the Contig:

SY0AAB48YO05FM1