Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YM07FM1
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00004485001 E-value : 1e-165
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_01504
Accession: ref|XP_363578.2| Score: 547 E_value: 2e-54
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01504 Score: 547 E_value: 1e-54
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3134 Score: 366 E_value: 5e-36
PFAM Definition: Arv1, Arv1-like family. Arv1 is a transmembrane protein with potential zinc-binding motifs. ARV1 is a novel mediator of eukaryotic sterol homeostasis..
Pfam Number: pfam04161 Score: 319 E_value: 2e-30
Swissprot: Q9HDX5|ARV1_SCHPO
Gene Ontology:
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane

Sequence:
>SY0AAB48YM07FM1
TTGGCTCGCTCCTTCAATGTCATCTACGCCTCCTACACCGCCAAAGAACC
TATACATCTGTATCGAATGCTCGTCGCCCGTGCAATCGCTCTACACGGCT
TACTCATCCGCCGATGATCGCTCCTTGGGACGCGGTGTGAGGCTCACGCA
GTGTCCGAGGTGTAAGAGGTTTGCTGACAAGTATGTTGAGCATGACTTTG
TTGTGCTATTCATTGACCTGGTATTAATTAAGCCTCAGGTCTATAGACAC
TTACTGTTCAACCGGTTAGGAAGGGAAGATGACAGATTCGAGCCGTCGAT
CGTCCGCCTCGGATTCCTCCTCCTCCTCTTTGACGTGTACCTAACCTGGG
CGCGTATTGAAAAGAATATACCAACTGACCCACTGAACACCTCCGCATTC
GGAATCCTAACCCAACGACCAATAGTCGTACAATACCTCTTCTTCCTCCT
CCTCTGCCTCACGGAATCCCTCCTCTTCCACCTCACAATCCGCCTAATCA
GTCAGTACCTTCTCGGCGCAACCCGCCCCAACGCCGTCTCAACTGCACTG
ATAGTATCCTCCTGCACAAAGCTCTTCCCAATACTGATGGTGATATGGAA
TTACGAGATCCCCGCCGCGGCGAAGTCGGTGGGTTGGGCGGTCGTCGTTA
ATAATG

Sequences in the Contig:

SY0AAB48YM07FM1