Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YK03FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00011498001 E-value : 1e-151
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein of unknown function DUF1486
Accession: ref|YP_001235826.1| Score: 358 E_value: 1e-32
KEGG Definition: protein of unknown function DUF1486
Accession: acr:Acry_2716 Score: 358 E_value: 6e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB48YK03FM1
TTGGGGAGTGGGGGACCCAGGCACCGGAGGAGTAGGCTACAAAAACCTCT
ACCACTTTTACAAGTACCACTTCATCCCTCTAAATCCGCCATCCTTGACC
ATGAAATTAGTCTCCAGGACTGTCGGCTCGGACAGGATCGTGGATGAGAT
GGTGGCAAGGTTCCGTCACGACACCCGCATCGATTGGATGCTGCCGGGAA
TTCCACCCACCAACCGAGTTGTCGAGATCGCACTCGTGAGCATCGTGTGC
ATCCGCGGCGGGAAACTCTATCACGAGCACATCTACTGGTTGGTCGTTTC
TTTCTTTCTTTCATTCTTTCTTTTTCGATGTTGAGGGGATCCTGGATTTT
GATCAGCGTGGAATAGGGACCAAGCAAGTGTTCTGGCACAGGTGGGCTTG
CTGGATGCCATGAATTTACCCATCGTTGGCGCGGAGGGCGCGAGGAAAGT
GCTTGAAGAGGGATACGTTGAGAGTAATAGGTTGATTCCTGAGTGGGATT
TTGGGAATTGGGTTGCTAGCCCGGAGCCCAGCGTACATGGTGATGGTGG

Sequences in the Contig:

SY0AAB48YK03FM1