Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YI22FM1
Length(NT) : 627
Best Gene Model Blast : Link to GSTUMT00003374001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG07369.1
Accession: ref|XP_387545.1| Score: 536 E_value: 3e-53
KEGG Definition: hypothetical protein
Accession: fgr:FG07369.1 Score: 536 E_value: 2e-53
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0316 Score: 563 E_value: 8e-59
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 110 E_value: 3e-06
Swissprot: Q9BRX9|MORG1_HUMAN

Sequence:
>SY0AAB48YI22FM1
TTGGGCCGCACGACACCAGATGTCTTCCCAACGCGCCAGACCGCAGTTCT
AACCAACCATGTTGGACCAGTGCATTGTGTGAGCTATAGCTCCGGAATCG
GACAATACATCCTAACCGGCGGCTCGGACCGGAAAATCACCCTCACAAAC
CCCACAACCGCCACCCCCCTCCAATCCTACACCTCACACGGCTACGAAGT
CCTCTCCCTCAGCATCTCTCCAGACAACAGCACTTTCGCCTCTGCCGGCG
GTGATAAACTCGTCTTCCACTGGGACGTTGCAACTGCAAAGACCCTCCGA
CGCTTCGAAGGCCACTTCTCGCGCATAAACGCCGTAACCCACAACGACGA
CGCGAGCGTGCTGATATCCGGTTCGTACGACGCCACGGTCCGGCTTTGGG
ACTTGAAGTCGCAGTCGCGGAAGGCGGTACAGGTGCTTGAGGATGCCAAG
GATAGCGTTACGAGTGTTTATGTAAAGGGCTGTGAGGTGTTGGTGGGCAG
TGTGGATGGCAGGGTTAGGAATTATGATGTTCGTATGGGGAGGTGCTTTG
TGGACTTGATTGGCTGGCCTGTTACTAGTGTTGGTGTCACGGCCGATGGG
AATGCCTTGCTTGTGGGTGCGCTTGAT

Sequences in the Contig:

SY0AAB48YI22FM1