Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YG08FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00000696001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Chorismate mutase
Accession: ref|YP_757216.1| Score: 226 E_value: 2e-17
KEGG Definition: chorismate mutase
Accession: mmr:Mmar10_1986 Score: 226 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: CM_2, Chorismate mutase type II. Chorismate mutase EC:5.4.99.5 catalyses the conversion of chorismate to prephenate in the pathway of tyrosine and phenylalanine biosynthesis. This enzyme is negatively regulated by tyrosine, tryptophan and phenylalanine..
Pfam Number: pfam01817 Score: 161 E_value: 3e-12

Sequence:
>SY0AAB48YG08FM1
TTGGAAATAAAAGCAGTTCACAGTCCATAGAGGATTGGTATATCTCATCA
GACCCTTAGCTCCATCACCGTTGCTCTTCCCGGGAGCAAACCTCCTCTCT
CGATTCTCCCCGGACAAAACATTTCCCACTTTGCTACCTACTCAAGCTCA
CAAATTTCCCCAAAAACAGCAAACTCTGACCACCACCGAACCCACAAATC
CGCAAAGATGGTTAACAAGAGCATCCATACCGCCATCGACCCAGCGAGTG
CAACCACTATGGCAGAGGTCCGTACCAGCATTGACGACCTTGACCGTCAG
ATTGTCGCTCTTCTTGGCGAGCGCATGCGCTTCATTGAGGCTGCTGCTCG
CATCAAACCTCATCGCGAGGCTGTCAGGGACCAATGGAGAGTGGATGACG
TCTTGACCAAAGTTGAAGCTGCGGCAGAAATAGCCAATTTCCCCAAGAAG
ATTGTCCACAAATTATATGCCGATCTTATCGAGTCCTCTATTCTCCATGA
ATTGGTCAATTTTGACCATCTTGCCGGAAATAACCTTAATGG

Sequences in the Contig:

SY0AAB48YG08FM1