Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YF09FM1
Length(NT) : 588
Best Gene Model Blast : Link to GSTUMT00002438001 E-value : 1e-148
Numbers of ESTs : 1

Blast Results:

Nr Definition: NAD dependent epimerase/dehydratase family protein
Accession: ref|XP_001276315.1| Score: 251 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: ani:AN8032.2 Score: 251 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: RmlD_sub_bind, RmlD substrate binding domain. L-rhanmose is a saccharide required for the virulence of some bacteria. Its precursor, dTDP-L-rhanmose, is synthesised by four different enzymes the final one of which is RmlD. The RmlD substrate binding domain is responsible for binding a sugar nucleotide..
Pfam Number: pfam04321 Score: 224 E_value: 1e-19
Swissprot: Q566L8|MAT2B_XENTR

Sequence:
>SY0AAB48YF09FM1
TTGGTAAAGAAAGCTGCTAATTGCGATAGCGACAACGAGAAGAGGGAAAA
AATAATCTGGGATCAGAATGTCTGAGAAAGTGGTTGTGGTTACTGGGGGG
ACGGGACAGTTGGGAAGGCAGTGTGTTAAAGCCTTTGAAGGAGCTAAGTG
GAAGACCATCGGGACTGGGTATTCCAGAGCAAATCCTCCAGCGATTTTGA
AGGTGGATTTGGGGAATGCAGGTGAGGTCGCTGGGTTGTTGGAGGAGGTG
AAGTATACTTCTCTCGGGCCAGTTATCTCACAAGGAGGCCTAATCTAACG
CGATGCCTTACGGATAGGCCCAAGGTGGTGGTTCACTGTGCCGCAGAACG
CTTCCCGGACAAGTGCGACGCAGACCCCGAGGGAGTCAAACGCCTGAACG
TTCAAGCATCAAACAGCCTCGCCCAGGAATGGTGCAAATCGTGACATAAT
CCTAATCTACATATCCACCGACTACGTTTTCGACGGGAAACCCGGTGCAG
CTCCGTACGAGGCTGATGCCGCGACTAATCCGGCTAACTTCTACGGAGAG
ACCAAGTTGGCTGGCGAACAAGCAGTCCTAAGCGCATG

Sequences in the Contig:

SY0AAB48YF09FM1