Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YD22FM1
Length(NT) : 213
Best Gene Model Blast : Link to GSTUMT00010126001 E-value : 1e-69
Numbers of ESTs : 1

Blast Results:

Nr Definition: protein kinase, putative
Accession: gb|EDP56427.1| Score: 142 E_value: 8e-08
KEGG Definition: protein kinase, putative [EC:2.7.1.-]; K00924
Accession: afm:AFUA_1G11930 Score: 142 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB48YD22FM1
TTGGGATGGAGAACAAAAGGGGTATCATAGACAGCAACAAGCGGCAGTAT
ATGGGGGTGTGAAATGCATCTCCATAGCGACACTTGTTGCTGTCTATGAT
ACCCCTTTTGCAACCTTTGCTTTCACAAAACTCATTAAGGGCGGATCCCT
CTACGACCTGGTCAAGGCAAACCGCCATGGAATATCCGCAAGACTGGCAC
AAAAATACTCCTT

Sequences in the Contig:

SY0AAB48YD22FM1