Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YD14FM1
Length(NT) : 594
Best Gene Model Blast : Link to GSTUMT00010054001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543887.1| Score: 511 E_value: 2e-50
KEGG Definition: hypothetical protein; K02542 minichromosome maintenance protein 6
Accession: ani:AN0228.2 Score: 498 E_value: 4e-49
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0480 Score: 422 E_value: 2e-42
PFAM Definition: MCM, MCM2/3/5 family..
Pfam Number: pfam00493 Score: 254 E_value: 5e-23
Swissprot: P53091|MCM6_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031261 = Cellular component: DNA replication preinitiation complex
GO:0042555 = Cellular component: MCM complex
GO:0005656 = Cellular component: pre-replicative complex
GO:0003688 = Molecular function: DNA replication origin binding
GO:0009378 = Molecular function: four-way junction helicase activity
GO:0005515 = Molecular function: protein binding
GO:0043142 = Molecular function: single-stranded DNA-dependent ATPase activity
GO:0006270 = Biological process: DNA replication initiation
GO:0006271 = Biological process: DNA strand elongation during DNA replication
GO:0006268 = Biological process: DNA unwinding during replication
GO:0006267 = Biological process: pre-replicative complex assembly
GO:0000084 = Biological process: S phase of mitotic cell cycle

Sequence:
>SY0AAB48YD14FM1
TTGGACCGCAATAGAGATGCGGCCATCACCCCAGAATTTACCACTGAGCA
GCTGCAGCGATATATCAAATTCGCCCGAACTTTCCGCCCTGTATTCACAG
AGGAAGCCCGCACTCTTCTTGTTCAGAAATATAAAGAACTGCGTGCGGAC
GATGCTCAAGGCGGCGTTGGAAGAAATAGTTACCGAATTACTGTCCGTCA
GCTCGAATCTCTTATCCGTCTTTCTGAGGCCATCGCCAAGGCCAACTGTG
TAGAAGATGTCACAGAAGGTTTTGTAAACGAGGCTTTTGGTCTGCTTCGG
CAGTCGATCATTCACGTGGAGAAGGAAGACGTCGAAATCGATGATGATGA
TGAAGCGGATGAGGAGATGCAGGAAGATATAGATCAGGAAAGCCGCGAAC
CCACCGCCGCGGTCTCCACCCCGGGCATGTCTAGTAGCCAGCCGCCTCGG
GAGAAGACAAAGATTACATATGACCGATACATGCAGATTCTCAACCTCAT
TGTACGTCGCATCAATGACGATGAGGAGAGCACTGGACAGGGTGTTGAGG
AAGAGGAACTTAAGACGTGGTATCTCGAGATGAGGGAAGAGGAG

Sequences in the Contig:

SY0AAB48YD14FM1