Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YD07FM1
Length(NT) : 553
Best Gene Model Blast : Link to GSTUMT00008248001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00334
Accession: ref|XP_001791024.1| Score: 495 E_value: 2e-53
KEGG Definition: hypothetical protein
Accession: yli:YALI0B15125g Score: 468 E_value: 2e-52
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0852 Score: 498 E_value: 2e-51
PFAM Definition: AhpC-TSA, AhpC/TSA family. This family contains proteins related to alkyl hydroperoxide reductase (AhpC) and thiol specific antioxidant (TSA)..
Pfam Number: pfam00578 Score: 145 E_value: 2e-10
Swissprot: Q9Y7F0|TSA1_CANAL
Gene Ontology:
GO:0051920 = Molecular function: peroxiredoxin activity

Sequence:
>SY0AAB48YD07FM1
TTGGAGATCATTGCTTTTTCTGATGCTGCCAAATCCTTCGAGGAGCGTGG
TGCCTCAATTGTCTTCGCTTCTGTGGATTCTGAGTATAGGTGGGTGTAGT
CGCGCTTGTTACTGATTGGACGGTTAGGATGGCAGCTGACGACGTTGCAG
CTTGCTAGCTTGGTCCAGTACTGAGCGTAAAGACGGAGGTCTCGGAAATA
TCAACATTCCCTTGTTCAGTGACAAGAACCATAAGCTTGCTGGGGATTAT
GGAGTTTTGATCGAAGAGGAAGGAGTTGCCCTCAGGGGTTTGTTCATTAT
CGATCCCAAGGGAACGATTAGACAAATCACTATCAACGATCTTCCTGTCG
GAAGGTCTGTTGACGAAACCCTTCGCCTTGTCGATGCTTTCAAGTTCACT
GAAAAGTATGGTGAGGTCTGCCCTGCCAATTGGAACCAGGGAGGCGAAAC
TATCAAGGCCAATCCTAAGGAATCGAAGGAGTATTTCAACAAGGTCCATG
GTTAGGCATCTGATCTGACTGGCAGGCGTAGAATCATGTTTCATTGATTT
GTC

Sequences in the Contig:

SY0AAB48YD07FM1