Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YC12FM1
Length(NT) : 517
Best Gene Model Blast : Link to GSTUMT00001912001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1984 Score: 111 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB48YC12FM1
TCCTCCCGGAGCTCCTACTCAGCCATCGTCTCATAGAAGGAATCAGTCTT
CTATGTCCGGAATGGGTGGTGCTACTGGCCCCCCACCTGCACCTTCTTCT
GGTTCATCTGGTACTTTTGGCGAGTTTTCTCATTCTAATTCAACCGGTAC
AAATAATAGTGCCCCACAACGTCGGCCCTCGGGTGCTACGGGAGGCCAGG
GTGGTGATGCTGGTAGAGGACATCAGCGTAGACATTCTCTTGCTCTTCCC
GAAGCGAAAAAGGCTGCCGAACTTGCGCAGGCACGAAGAGGCCAGGCCGG
TTTCCAGTTCTCCACTGGAGGGGCATCAGGAAGCCCTGCCACTGCTACAG
CCAATGGATCAAGCCCAACAACTGGTGGTGCGGGCTCTCCTGCAACCGCC
GGTTCCCCACCTGCTGCCAGGGAGACACCCGCCACGACAATTGCCCCTGG
CCAAGCACAGACAGCAACTACTAATCCGCCGGCAACACTGGCCCCCCCTA
GACCTAGAATGGGCGGT

Sequences in the Contig:

SY0AAB48YC12FM1