Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB48YC08FM1
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00010158001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001749461.1| Score: 222 E_value: 5e-34
KEGG Definition: hypothetical protein
Accession: ncr:NCU00018.1 Score: 326 E_value: 4e-29
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0730 Score: 169 E_value: 4e-13
PFAM Definition: CDC48_N, Cell division protein 48 (CDC48), N-terminal domain. This domain has a double psi-beta barrel fold and includes VCP-like ATPase and N-ethylmaleimide sensitive fusion protein N-terminal domains. Both the VAT and NSF N-terminal functional domains consist of two structural domains of which this is at the N-terminus. The VAT-N domain found in AAA ATPases pfam00004 is a substrate 185-residue recognition domain..
Pfam Number: pfam02359 Score: 211 E_value: 5e-18
Swissprot: P54812|TERA2_CAEEL
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0009792 = Biological process: embryonic development ending in birth or egg hatching
GO:0007626 = Biological process: locomotory behavior
GO:0002119 = Biological process: nematode larval development
GO:0040010 = Biological process: positive regulation of growth rate

Sequence:
>SY0AAB48YC08FM1
TTGGCAGCACTGCTACCATATCCCACCTCGCTTCATCTCTCAAGCTCTAT
CTATCTGATTTGCTCCTTCATTCTTCCTACCCAAGATGGCTGATCATGAA
GAGAAAAAGAAGGTTAATCTGGCCGATGCCTCAGGCGCCACTCACAAAGA
GGCGGACGAAACCGCAACGGCAATCTTAAAGAAGAAGAAGAAGCCGAATA
GCTTGATTGTCACTGATGCCGTTAATGATGATAATAGTATCATCGCCTTG
TCTAATAATACCATGGAGACGCTTCAACTGTTTCGTGGGGATACTGTGCT
TGTCAAAGGGAAGAAGCGGAAGGACACAGTCCTTATCGTTCTGGCGGATG
ATGATCTTGATGACGGATCTGTGAGAATCAATCGTGTCGTTAGAAACAAC
CTCCGGATTAGACTGTTTGTCTTCCCAGCATGGTTCTGAAATCTATTCCG
GAAACTAACCTAGGCGTAGTGGCGATGTCATTACCGTACACCCGTGTCCT
GATATTAAATACGCGAAACGTATTGCCGTTCTCCCTATTGCAGACACTGT
TGAAGGATTGACTGGATCTTTGTTCGATGTCTACTTAAAGCCATACTTCC
TTGAGGCCTACCGG

Sequences in the Contig:

SY0AAB48YC08FM1