Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YL16FM1
Length(NT) : 529
Best Gene Model Blast : Link to GSTUMT00011319001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_02468
Accession: ref|XP_001596248.1| Score: 553 E_value: 2e-55
KEGG Definition: hypothetical protein
Accession: ang:An11g06650 Score: 509 E_value: 2e-50
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0347 Score: 445 E_value: 3e-45
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 205 E_value: 2e-17
Swissprot: A7EAY2|MAK5_SCLS1

Sequence:
>SY0AAB47YL16FM1
TTGGCAAACCTGAACCTCCCCGCCCACCCCCTCCACTCCAAAATGATCCA
AAAAGCACGCCTCCGCTCCCTAGAACGCTTTTCCTCCCCAACATCCCCCC
ACTCCATCCTGGTAGCAACAGACGTCGCCGCCCGCGGCCTCGACATACAA
AATGTCGACTTTATAATCCACTACCACCTCCCCCGCACCGCAGACACGTA
CGTCCACCGCTCGGGCCGTACAGCGCGCGGCACAGATGCCCGCGGTGTTA
GTATCCTACTATGTTCACCGGACGAGGTCATCGGCGTGCGTAGATTGGTC
GCGAAAGTGCACGACCCGGAATCCCTATCGACGGCACGCTACGCCATGCG
TTCTTTCGACGCCGATAGGAAGCTAGTCACGAGGCTAAAGCGCCGCGTCG
AGCTTGCGAAGAAAATAGCCGACTGCCAGATTGAAAAGGCGAAGAAGGGG
CATGAAAATGAGTGGTTGAAGGCTGCCGCGGAGGATCTAGGCGTTGAGTA
TGATAGCGATTGCTTCGCCGGCAGCGGTG

Sequences in the Contig:

SY0AAB47YL16FM1