Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YK04FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00002246001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09622
Accession: ref|XP_001552010.1| Score: 267 E_value: 5e-22
KEGG Definition: hypothetical protein
Accession: mgr:MGG_09025 Score: 244 E_value: 1e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB47YK04FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCGTGCCCACCGCACTT
GCCATCGATGAGGATAGCGATGTTAAACAGGTCGTGAATGTCACAGTCGG
ATTTGAAAATGGGGGCTTTGGATTGTATCAGCTGGACACAGCCACTGGAT
CATTACCAAAGCTGACCTTTGAATATTCTTACGCTGGGCCCGCTCCTTCT
GCGGGAGACAGCCGTTCACAAGGGCTGATGATCACTTCTATGGCTTATTG
TTCACCATACCTGCTAACAATGTCATCCTCGCAGCTGCTCACAGTCTATC
GGTTCAGCGGATCAGCCGACAGAGGCAGCAGCAGCACTGAGAGGGATTTC
AGCAAGGATTTACCGATACCAGAAGGCCGCATGATGCATGCACCGAAAAT
CCTCTCATCTTTGCGGTCACATACAGTTTGGCCCCCCCTATCACTCTCGC
TACGACGATCAGCGCAAAAGTCCATGATTGCTAGTATTGCGTACGCATTC
CCGCTTCACATCTCAGGTTGGTCCGTAGGGATCCAAGAACTCCGCTTTAC
GGATGACGCGGATACTGTGGTGGAGTCAAGGAT

Sequences in the Contig:

SY0AAB47YK04FM1