Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YJ07FM1
Length(NT) : 338
Best Gene Model Blast : Link to GSTUMT00008161001 E-value : 3e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN4046.2
Accession: ref|XP_661650.1| Score: 157 E_value: 1e-09
KEGG Definition: hypothetical protein
Accession: ani:AN4046.2 Score: 157 E_value: 7e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB47YJ07FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGGAGGGCAAGGGCGGCGAA
GCCAAGGTTCTCGTGGTGAGGAATGCGGGGCATCATCTCTATCTGGACGG
GTGGAGGGAGTTTAATGGCCTAGTGCTGAAGGAGATGGAGGATGTGGAGA
AGAGGGAGAATTTGAGAAGGCAGGTGGCATAGGTTATATATAGAGAGGGT
TGGCCGAAATGATCTGGGATTTTGGTGTACGGTACTGCAATGCGGGGTTC
TTTTTTCTTTTCTTTCCCTTTTCCCTTTTTCTTCCGTTTCACGGGCAGAT
TTTGTGTATGTGTTGGTATAAACATCTAAATTTCTGAT

Sequences in the Contig:

SY0AAB47YJ07FM1