Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YG19FM1
Length(NT) : 458
Best Gene Model Blast : Link to GSTUMT00005367001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09796
Accession: ref|XP_001240175.1| Score: 548 E_value: 7e-55
KEGG Definition: bifunctional pyrimidine biosynthesis protein (PyrABCN), putative [EC:2.1.3.2 6.3.5.5]; K00609 aspartate carbamoyltransferase catalytic chain; K01955 carbamoyl-phosphate synthase large chain; K01956 carbamoyl-phosphate synthase small chain
Accession: afm:AFUA_6G11310 Score: 537 E_value: 6e-54
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1504 Score: 128 E_value: 1e-08
PFAM Definition: OTCace, Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain..
Pfam Number: pfam00185 Score: 260 E_value: 6e-24
Swissprot: Q09794|PYR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004070 = Molecular function: aspartate carbamoyltransferase activity
GO:0004088 = Molecular function: carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity
GO:0004151 = Molecular function: dihydroorotase activity
GO:0006207 = Biological process: 'de novo' pyrimidine base biosynthetic process
GO:0006531 = Biological process: aspartate metabolic process

Sequence:
>SY0AAB47YG19FM1
TTGGCCCGCAGAAGACAGTGCCGCTGAGGCAGCAAGGTTCTCCCCAGTCC
CCATTATTAACGGAGGAAACGGAAGTCTTGAACACCCGACTCAAGCGTTC
CTCGATTTGTTCACTATCCGTGAGGAGCTGGGAACTGTTAATGGATTGAC
CATCACGTTTGTCGGCGATCTCAAATTCGGCCGTACGGTTCACTCCCTCG
CCAAGCTATTGCAGCATTACCACGTTCGCATCAACTTTGCCTCCCCCCCG
CAGCTCTCAATGCCAGCCACCGTCCGTGATTCTCTCAAGAAGGCTGGAAT
GGAGGTGAAAGAGTACCACGAACTCATACCAGACCTTGTCGCTAGCTCAG
ATGTACTTTATTGCACTCGTGTCCAGAAGGAGAGATTCGCAGATTTGAAC
GAGTTTGAGAAGTTGAAAGATAGCTTCATTATCGACCACTCGGTTCTAAA
GAATGCGA

Sequences in the Contig:

SY0AAB47YG19FM1