Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YF17FM1
Length(NT) : 580
Best Gene Model Blast : Link to GSTUMT00001193001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g03610
Accession: ref|XP_001394360.1| Score: 209 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: ang:An11g03610 Score: 209 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB47YF17FM1
TTGGCAACAATCAAGGCTTTCTTTCAAGAAGCGTTTCTCATCGCGACGGT
ATGCCTGAGATTGTCGCTTATATGCATTAGCCCTTCGAATCATTAACTTA
ATCACGGAAAGGACTCGCACGGCGGCCAACCCCAACATCCAAGGCGATTT
TAGCGGTAACAGTGGTTCTCATAACAATCTCAACTCTGTCAACACCAACT
CGGGTAACACCAATACGGGGAACATCAATTCCAGTAACATCGGTTCGGTT
AACATTAACTCCAACATCAATGCCGGCAATACTACCACTATCACCACTTA
CAACCAGGGGGGCACGAACTCGTCCGGGGAGTATAGCGAGATTTTGCAAT
GCCTATACACATCTGCTTACGGGGAGCACCGGAACCGTGTTCGTGAGCCG
GTCGAGGGGACATGCACCTGGGTTATCAAACATCCAAAGTATTTGGACTG
GTTGGGAAAGCGGACAACTGGTCCGCTCTGGATATCCGCGGACCCAGGTT
GCGGAAAATCGGTTATCGCTTCATTCCTCATCACGCATTTACGGGTTCAA
ACGAGGGCTACTATTTGTTATTTCTTTTTC

Sequences in the Contig:

SY0AAB47YF17FM1