Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YD12FM1
Length(NT) : 669
Best Gene Model Blast : Link to GSTUMT00008413001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 316 E_value: 1e-27
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 297 E_value: 1e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>SY0AAB47YD12FM1
TTGGGACGAGTGCGACGAAATGACTATAACCCCGCTTATCGGCCACATAA
CAAGTCTACAGGAATCACAACCTTGCGACATACCGTTGAAATTCCTTGTT
ACAAGTCGCCCGTACCAAAGGATTGAGATTAAGTTGAGCTCATCGGAAAC
GACAATCCGACTAAAAGGGGAGGAGGAGGTCAGCTCTACTACCGCAGACG
TTAGGCGAGTAATAAATGAAGGTATCAAAAAACTCGAGTCGTATTGGAAG
CGGCCCGGGGGACTAGCATACCTGCGCGATCTTCTCGAGTCATCTGCCGA
CAGGACATTCCTTTGGGTTTCTCTCGTTCTAGAAAGCTTGCAGGATTGTC
AGGATGATTCGCCGGAGCGGTTTACCAACATTATCAACACTGCGCCGCGT
GATTTAGCACAATTTTACACCAGTATTCTTGATAAGAGCCAGGAGCCCGA
CGATGCAAGACGAATCCTGAATATCGTGGTAGCGGCTGCAAGGCCTCTCA
CGCTTCAGGAAATGCATATCGCATTTAGGATCAGGCGGTATCACACAACT
ATGAAGAACCTCGGAGATCTTTCTCCCGAGTTCGGAAGGATAGTTAAAAA
TTTGTGTGGTCTTTTCGTGCGCGTTATTGATGAAAAGATCTACCTCGTCC
ACCAAACGGCAAGGGAGTT

Sequences in the Contig:

SY0AAB47YD12FM1