Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YC06FM1
Length(NT) : 654
Best Gene Model Blast : Link to GSTUMT00000847001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_01420
Accession: ref|XP_001220641.1| Score: 458 E_value: 4e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG00369.1 Score: 458 E_value: 2e-44
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2667 Score: 376 E_value: 4e-37
PFAM Definition: No Hit Found
Swissprot: Q09895|YAI8_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB47YC06FM1
TTGGCCCAACTTTTTTGTACAAAGTTGTCCCCCTCCCCTTTCTCACTCCT
AGGCTTTTCACCCCCTCCATAGCAGGGCTTTTCCTACTCTCTTTCTATTG
TTTTCATTTATTCACTCATTTTCACCCCGGATACGGTAACAAAATCTTCT
GATTTTTGCCCTATCCCACCGGAATTTAAAATGGGACGAGGCTCACGGCT
TACCCGTCTGGATGCCTTCACCAAGACGGTGGAGGATGCGCGTGTCCGGA
CCACCTCTGGGGGAATAGTTACTCTCGTCAGTTTGTTTGTTGTGTTCGTT
CTGGTGGTTGGTGAATTCCGGGAGTATCGGCGGATTCAGGTGCTCCCGGA
GTTAGTTGTTGACAAGACTCGTGGGGAGCAACTCCCCATAAGCCTCAACA
TAACATTCCCCCACATCCCCTGCGAGCTTCTAACCCTGGACGTAATGGAC
GTCTCTGGCGAGCAGCAATCCTCAATAACCCACGGAATCCACCTAACTCG
TCTAACCCCCTTCCCAGAATCTAAACCAGTCTCCACCACCTCCCTGAACG
TCCACGAGGACACGGCATCCCATCTTGACCCAGCCTACTGCGGAAAATGC
TATGGCGCCCCAGGCCCCGAGAAGGACAAGGGCTGCTGCCAAACCTGTGA
AGAC

Sequences in the Contig:

SY0AAB47YC06FM1