Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB47YA04FM1
Length(NT) : 553
Best Gene Model Blast : Link to GSTUMT00005090001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: nucleolar protein
Accession: ref|XP_001559651.1| Score: 187 E_value: 8e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG10908.1 Score: 173 E_value: 2e-11
KOG Definition:
Classification: [RNA processing and modification, Translation, ribosomal structure and biogenesis].
Kog Number: KOG2572 Score: 131 E_value: 7e-09
PFAM Definition: No Hit Found
Swissprot: Q12499|NOP58_YEAST
Gene Ontology:
GO:0031428 = Cellular component: box C/D snoRNP complex
GO:0032040 = Cellular component: small subunit processome
GO:0017069 = Molecular function: snRNA binding
GO:0000154 = Biological process: rRNA modification
GO:0006608 = Biological process: snRNP protein import into nucleus

Sequence:
>SY0AAB47YA04FM1
TTGGACCAAGACGGCCCTCGGTTTGAGAGTTGACGCTCTAGCCGACGATA
AGGATGGATCGGCGACTTTAGGCTTGGAGATGAGAGCCATGATTGAGAAC
AGAGTTCGAAAACTCGAGGGCAAGCCGGCTGTTCCTCGTGGCAACGCCAA
CACAACATCCATCGTCAGTTTGAGAGCACCTGGGAAGTGGGAGATAAAGG
AGGCTAAAAAGTACAACCCCGATGCGGACACTGCCATGGAGGATACACTG
CCGGCCGCTCAAGCGGTAGCCGAGGCCGCTGTAAGGGCTATCGGCCAAGA
TTGCCATGGGCGACGACGACGAAGAATCATCCGAGGATGGTGAGGAGGCG
GAGAAGACCGAGAAGGGAAAGAACAGTCTCGTACCTGTTATTCCCACATC
CAAGGATGACAAAGAAGGGGAAAGTAATGGGGACGACGAAGATGAGGAAG
CAAAGAGGAAGGCTGAGAAGAAAGCCAGGAAAGAAGCTAAAAAGTCCAAG
TCGTCCAGCAAGAAGAGACGAAAGAGTGAAGTCTCTGAGGAGCACAAGAA
CAA

Sequences in the Contig:

SY0AAB47YA04FM1