Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YP18FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00007184001 E-value : 7e-74
Numbers of ESTs : 1

Blast Results:

Nr Definition: gag-pol polyprotein
Accession: gb|AAO73523.1| Score: 114 E_value: 8e-12
KEGG Definition: AgaP_ENSANGG00000026070; ENSANGP00000030080
Accession: aga:AgaP_26070 Score: 112 E_value: 3e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P10978|POLX_TOBAC

Sequence:
>SY0AAB46YP18FM1
TTGGTCTGACTTCTGCTTAAGAAGTGATACAGCAATACGCCCAGATCCTT
CATCGATAAATGTGGCAAAGTACCGCTCTCCCATAAAGCCAGTACTCGCC
ATCGGTCCACACACATCTGAGTGGATTGTGTGTAACAACTCCTCGCTCTT
GACACGTTCTCCGCTTGTTCGTTTAGAGATCGGTGAGCAATTCTTCTATG
CCAAATTTCCTTTGTTGTAGCGTCCTTCCGATCCGTGAGTCCTGCGAATG
CTATTTCTTGTAGCCCAGCTACAAAATAGATATTCCCTTGTCGTCTGCCG
ATTACACTTTCGGTATTTCGTTTATTGACACTGCATCCGGTCCTTGTAAA
CTCGACATGGAATCCTTGGTCGACAATACTGGCGACGCTCAGTAGGTTGC
TACCGATATCAGCAACTCACGTCGGGTGGTAAGGTGCCTCGATGCACCTG
AGTCGATTATCCAATCCGACTCTCCAATCGCTGGCTTTGAATAGCCCATA
AACGCTAAATGTCCTCCACCCGAACCCCGCTGTAAGTCTCCCTTCCTCTT
ATAGCACTCATTCTTCCAATGACCCTCTTTGTTGCAGTAATGGCAGCGTC
CGCTCACCATGCCTTG

Sequences in the Contig:

SY0AAB46YP18FM1