Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YO16FM1
Length(NT) : 621
Best Gene Model Blast : Link to GSTUMT00002798001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: C-8 sterol isomerase
Accession: ref|XP_001526536.1| Score: 500 E_value: 5e-49
KEGG Definition: CaO19.6026; sterol C8-C7 isomerase
Accession: cal:CaO19_6026 Score: 496 E_value: 7e-49
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4143 Score: 561 E_value: 1e-58
PFAM Definition: ERG2_Sigma1R, ERG2 and Sigma1 receptor like protein. This family consists of the fungal C-8 sterol isomerase and mammalian sigma1 receptor. C-8 sterol isomerase (delta-8--delta-7 sterol isomerase), catalyses a reaction in ergosterol biosynthesis, which results in unsaturation at C-7 in the B ring of sterols. Sigma 1 receptor is a low molecular mass mammalian protein located in the endoplasmic reticulum, which interacts with endogenous steroid hormones, such as progesterone and testosterone. It also binds the sigma ligands, which are are a set of chemically unrelated drugs including haloperidol, pentazocine, and ditolylguanidine. Sigma1 effectors are not well understood, but sigma1 agonists have been observed to affect NMDA receptor function, the alpha-adrenergic system and opioid analgesia..
Pfam Number: pfam04622 Score: 543 E_value: 1e-56
Swissprot: P32352|ERG2_YEAST
Gene Ontology:
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAB46YO16FM1
TTGGTTCTCCCTCCCCCACCGCACTAGCGACTTCAAAAACTACCACCACA
TACACCCAGCCAATTACCGCCGACATGCGCGTAATAGCATACCTACTCGT
GCTCCTGCCAATCCTCTACTACTCGATTGACACCATTCTCCCTCGCTTCT
TCATTTTCGACCCCGTTCGGCTGCAACAGCTATCGCAGGCTTCTATCGAG
AAGTTTCCCGACAATGCCACGCTCTTGATGGAAGATTTGCAGGCTTCGTT
GTTGGCGGAGTATGGGGATAAGCATATCAATAGGTTGAGGAAGGATGCGT
GGTTTTTTAATAATGCTGGTGGTGCTATGGGCTCAATGATTATCCTCCAC
GCCTCCGTCACAGAGTACCTCATCCTCTTCGGTACTCCCCTAGGAACGGA
AGGCCACTCCGGCGTCCACCTCGCACACGACTATTTTACAATTCTCCATG
GCGAGCAGTCTGTCTTCTATCCCGGCGACCTCGAGCCAACTGTGTACAAA
CCTGGCTCGCAGAACCACCTTCCAAAGGGTCGTGCGGTGCAGTACATTCT
TAATGGATGGGCTCTGGAGCTTGCGCAAGGTTGGATCCCATCCATGCTTC
CGTTCGGCTTCCTTGACACTT

Sequences in the Contig:

SY0AAB46YO16FM1