Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YM07FM1
Length(NT) : 581
Best Gene Model Blast : Link to GSTUMT00009336001 E-value : 1e-159
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001214020.1| Score: 279 E_value: 2e-23
KEGG Definition: predicted protein
Accession: aor:AO090005000844 Score: 270 E_value: 1e-22
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2543 Score: 224 E_value: 1e-19
PFAM Definition: No Hit Found
Swissprot: O43114|ORC5_SCHPO
Gene Ontology:
GO:0005664 = Cellular component: nuclear origin of replication recognition complex
GO:0005656 = Cellular component: pre-replicative complex
GO:0005657 = Cellular component: replication fork
GO:0005524 = Molecular function: ATP binding
GO:0003688 = Molecular function: DNA replication origin binding
GO:0006270 = Biological process: DNA replication initiation

Sequence:
>SY0AAB46YM07FM1
TTGGACAACCGATAAAAAAGAAAAAAAAAATAAAACGGAATGACCGACGA
GATGCTCCCAACAGAGCTCCTCACAACTATGAACGAGCAATTCCCTTGCC
GTGCGCCTCAAATTCGCCGTCTGGCAGCGTTGGTAGGGACTGATGAAACC
CCCAGTCCTCCCGCCATTGTCCTCCATGGACTCGAAGCAACCGGGAAGAC
AACCATCCTGCGCACTTTCATGGACAGCGTTAACGCTTCGTACACGTGGG
TTGCCTGTCATGAGTGTGTTACGGTGCGACAGCTGATGGAGCGTATCAGC
GCGGGGGTCACGGAGAATGTTGGGGGTGGTGATGCTGGACGGGCAGGTGA
TGTGTGTGCTCTTGGAGTGAGGCTTTCCGGGGTGCTGAGCGGTGTTGAAC
GGAAGCATTTCTTGGTGCTGGATCGCGTTGACAGGACGAGGGAAGGGAGT
AGTGTGCTGTTTGCTGCTCTGGGGAGGCTGGGAGAAATGATCCCGATCCT
AACAGTAATCTTCATCCTTTCAGTTCCAAAGCCCCGCCTCTTGAGCTCCG
CAGAACCCCCACACATCCACTTCGCCCCCTA

Sequences in the Contig:

SY0AAB46YM07FM1