Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YL20FM1
Length(NT) : 489
Best Gene Model Blast : Link to GSTUMT00002629001 E-value : 1e-134
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_01101
Accession: ref|XP_001791758.1| Score: 159 E_value: 9e-10
KEGG Definition: RAB GTPase Ypt5; K07976 Rab family, other
Accession: mgr:MGG_01185 Score: 158 E_value: 6e-10
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0092 Score: 175 E_value: 6e-14
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 153 E_value: 2e-11
Swissprot: P36586|YPT5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005525 = Molecular function: GTP binding
GO:0006886 = Biological process: intracellular protein transport
GO:0031338 = Biological process: regulation of vesicle fusion
GO:0007264 = Biological process: small GTPase mediated signal transduction

Sequence:
>SY0AAB46YL20FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTTCGAAACGAGCTGTTGAAACTGCTGAGGCTGAAGCGTATG
CGCGGGAAGCTGGCCTCCTCTTCTTTGAGACCTCAGCAAAGACCGCCGAA
AACGTCAAGGAACTCTTTACTGCTATCGCAAAGAAGCTGCCGTTGGACCA
ACAAGGGCCTAGGGGCACAACAAGAACCGGTGCTGCTGGTGGTCGAGGCG
TCAACTTGAGTGGTGCGAATGCAGCACAACAGGGGTGTAATTGCTGAGTG
ACCCCAGGGTCATGTGTACATGGATGGGATCAATGGTGTTCTTTTGTGAT
TTTTTCTCTCTTTTTCCTGTTTGCCTAGTCTCTCTGTTTGGTAGTCATCT
TTTATATTGGTGGACCTGTGTGGGATCCTATACTGTGGCCGGTAAACGAA
GGATTGTAGTAATGACATCTTGGAACGGCAATGGCTGTG

Sequences in the Contig:

SY0AAB46YL20FM1