Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YL18FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00008941001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503693.1| Score: 243 E_value: 3e-19
KEGG Definition: hypothetical protein
Accession: yli:YALI0E08360g Score: 243 E_value: 2e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P10356|YEY2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB46YL18FM1
TTGGCAAACCTATTTGCGCATGGCGAACCCGGTATGGTTCCAACGCCGCA
GTAACCCCGCCCCCTCCTCCCTTTCTCTGACAATTCTGGGTTTCGCCCCT
GCTCACAAAGACTCGAGAGAAGGGGGATCTGATCTCTCCTCTCTGGCGTC
ATTAGCCCGACTCAAAATCTCATCATCCGTATCGTATCCTCCGCCCCAAC
CTTGCGTTAGTCCGAGACAAAAGAACCAACTAACGGCACAGTGTACGGTA
CACAGTCCAACATGCTTGCTAACCTCCATAAACCAATCGATCTCCTCCGA
GGCCACCCATCGACCCGCCTTCTTGCAGTGGACCTGATTCGCGAGTCCGC
TGCTAAGGTCCTTAGCTCTGACCTTCCACAGGATAGTTATGCCCAGGTTC
GCCACCCATTACATTACGGACCTAACATGGGGAACGAGGACTTGCGTGCT
GAGATTGGAAGATGGACTGCTGAGCGATATGAGCTCAAAGAAGCCATTCC
TGCGGAGAGAATTAATATCACTCCCGGGGCATCGTATGGGCTTATGAGCA
CGCTTTTACTGTGTACTAGTCCCGGAACTGGGTACACGAAGCAGGCGTTC
GTCGTTAGCCCGACCTACTTTTTAGCAGCA

Sequences in the Contig:

SY0AAB46YL18FM1