Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YJ08FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00003123001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12657
Accession: ref|XP_001549238.1| Score: 195 E_value: 3e-25
KEGG Definition: hypothetical protein
Accession: fgr:FG01356.1 Score: 198 E_value: 6e-25
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4100 Score: 159 E_value: 4e-12
PFAM Definition: ACN9, ACN9 family. Mutants of the yeast ACN9 gene have two- to fourfold elevated levels of enzymes of the glyoxylate cycle, gluconeogenesis, and acetyl-CoA metabolism. The ACN9 protein was localised to the mitochondrial intermembrane space..
Pfam Number: pfam05882 Score: 155 E_value: 1e-11
Swissprot: Q4IN52|ACN9_GIBZE
Gene Ontology:
GO:0005758 = Cellular component: mitochondrial intermembrane space

Sequence:
>SY0AAB46YJ08FM1
TTGGCACAAGTTTTTACTCCCCCCCTTTCCCCAGCTGGACAAAATGCGCC
AAACGCTCCTCCGTTGTGCTTCGGAAATTATTTCCAAGTCATTCGTACAA
AACCCTCCTCGCACTCCTTCCACCAATCAAGCTTTACCGCCGGCTTTTGC
GCGCTCACAGACATAAACTATCGCCCGAGAAACGAGTTCTCGGAGACGAG
TATGTCAAGGCGGAGTTTAGACGGCACAGGGATATCGAGAATCCCTTGTA
TATTGTTCGCTTCCTTCCTTCACTTTGATTGTTTTCCTTAGGTAGGGGGG
ATAATGGGGATATGTCAGGTCGGCTTCTTGAAGGAATGGCAATTGTACGC
GCAGGCGGTTGAAGGCGAGACGTGGAAGGACGAGAAACTTGAGGAGGGAA
AGTTGGAGAAAATGAGTGATCAACAGATTGCGCAGCTGTATGAGTTGATG
AGGGCGATTAAGCGTGGGGACACGGACGCTGGTGGGGAAGGTGAGGGAAG
GTTATAGGGGTGGCTTTATAAACGTTTTGTTGAAACTAACTACTTTGTCG
GGGTTGGTTACATTT

Sequences in the Contig:

SY0AAB46YJ08FM1