Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YI19FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00010420001 E-value : 3e-48
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein UM05663.1
Accession: ref|XP_761810.1| Score: 141 E_value: 2e-07
KEGG Definition: hypothetical protein
Accession: uma:UM05663.1 Score: 141 E_value: 9e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9P305|IGO2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB46YI19FM1
TTGGCCCCACGTCCCACTCACCACACCAACCCTTTCACAAGGGCGACAAG
CAATCGACTAGCGATCAAACCTAGCGAAAGCCTCTCTCTTCATAACCACC
CACCCAACTACAACCAGCTCTCTCTACCTTTGAACTCTCCTACCTCACAA
ATCAAAATGACAATGAATCCTCATCAGAAGCAGAAGGTGGACATCAGCGT
GAGTGGTTTTTCTCTTTCGAACTACCCCACCTCCCCGCATTGGATTATCT
CGTGGAAGGGGAGGGAGGAAGGGGGAGATAATCCCAACCCGCTACCTTCT
CTCCCCGCTTTGAGCTATACCACGTTACCTTGTCAGAAGCATGACCAAAA
ACTGACGATAAGAGAGGGAAACCTGGAGGGGAGGTTGTTCTTCGCCAATG
GGTTATCGCTCGAGACCCTCCCGGCGAACGAATGACCACACCTTCCTAAA
GTCCCGCATTTTTCACGATTCGCAGTCCTTGAATGAAGAGGAGCAGAGGC
TCTTTAGACTATACGGGAAACTTCCGTCCAAGAAAGATATTCTCAAGAAT
AAACTTAAAGAACGCAAGTAC

Sequences in the Contig:

SY0AAB46YI19FM1