Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YI09FM1
Length(NT) : 613
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: SIR2 family histone deacetylase
Accession: ref|XP_749719.1| Score: 167 E_value: 2e-10
KEGG Definition: SIR2 family histone deacetylase, putative [EC:3.5.1.-]; K01463
Accession: afm:AFUA_2G05900 Score: 167 E_value: 1e-10
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG2682 Score: 125 E_value: 5e-08
PFAM Definition: SIR2, Sir2 family. This region is characteristic of Silent information regulator 2 (Sir2) proteins, or sirtuins. These are protein deacetylases that depend on nicotine adenine dinucleotide (NAD). They are found in many subcellular locations, including the nucleus, cytoplasm and mitochondria. Eukaryotic forms play in important role in the regulation of transcriptional repression. Moreover, they are involved in microtubule organisation and DNA damage repair processes..
Pfam Number: pfam02146 Score: 118 E_value: 3e-07

Sequence:
>SY0AAB46YI09FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCGCTCCTGCCTCTGACCGA
CCCGCAAACTGCTTCCAACTCCTCCATCAACCCCGGCTCCCCCACCAGCT
TTCCCACCTCCTCATCGCTCCCGGTCAGAAAAAGCACATCGTCCGCCCAT
CCACCACTTCCTCCCTACTCGTTCGTTAGAAATTATAACCTTAGCAGCTC
CTCCTTCATCCGTCTGGGAGATACGGAGGGCGGATGGACTATCAACGAAC
TCGGCATAACTGCCAAGTCCGCCTCCTCGACAATTCTAAGTGCCGCAAAA
AACTCCCTCGGCAAACTCTCCCGAAAGAATGCAAAATCTAGCTACACCAA
GCCTGCGCAAGCCGTGGGCCGGGGAACACTTCCCCCGATAATGCGCTCCT
TCAGGTGTCACCCCCATATTCCATGTATTTATTAACCAAGTACCGCCGAA
CCCGTCTAAGGCTATGACCAAGAAACCCACCGCCTTACCGAAACCGTAAG
AACCGGATTCAAACCGGCGACCATGAGCAGCACGAGCATGCGGCGTGACA
ATCAACGCACGATTGTCCCGTGAACAAACCATGGGCTTCGGTAGGCTGTG
GTGGGCCTCTCCC

Sequences in the Contig:

SY0AAB46YI09FM1