Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YH09FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00004970001 E-value : 1e-175
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03320
Accession: ref|XP_001595231.1| Score: 347 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: fgr:FG08725.1 Score: 317 E_value: 3e-28
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4114 Score: 234 E_value: 7e-21
PFAM Definition: No Hit Found
Swissprot: Q02772|PT191_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0008535 = Biological process: respiratory chain complex IV assembly

Sequence:
>SY0AAB46YH09FM1
TTGGATTCATTACACAAACAATGCCGTCCTCGTGCAAAGACATTCGAGCG
GCACTGGCCCAATGTCTTGAAAATTCTGACTGCGTGATGGTCGATCGCAA
CAAACCAGCTGATTGTCTCCGGTATCCACTGGTCGAAACACTACCAACCC
GATGTCAACGGTTGAAGAAAGGCTACGGTGAATGCAAGCGGGGAATGGTT
GATATGCGAAAACGGTTTCGTGGGAACTACCCTGTTGCTCTTTCTGTGGA
AAATGAAGGGGGAGGCGGATCTCGTCAATTATACGGGGGGGGATCTGCAC
TTAGTGACCCTCCATCTGGCACAAAGGCTGAAGGTAAGGAAGGGGGGAAG
TGAAATTAGAAGGTAGCAGTTAACTTGAGTTGTCGGAGTTTTTGAGTTAC
CGGTAGTATGCATACATCGTACCGTTCTTGCGCGTGTACCGTATACACAT
AGGTGCGGGGCTTAGTTAGGCCACTCACTTTTGTATGAATCGTGGGATTT
GAGACATTCAGATCGG

Sequences in the Contig:

SY0AAB46YH09FM1