Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YG13FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00008504001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2891 Score: 143 E_value: 3e-10
PFAM Definition: MAP7, MAP7 (E-MAP-115) family. The organisation of microtubules varies with the cell type and is presumably controlled by tissue-specific microtubule-associated proteins (MAPs). The 115-kDa epithelial MAP (E-MAP-115/MAP7) has been identified as a microtubule-stabilising protein predominantly expressed in cell lines of epithelial origin. The binding of this microtubule associated protein is nucleotide independent..
Pfam Number: pfam05672 Score: 145 E_value: 2e-10

Sequence:
>SY0AAB46YG13FM1
TTGGGGTATCCGCTGGTGTTGAGCCACAATTGCATTTGGGGATCACCAGT
TTGGCCGGAGGTGTTGCTACCGGAATGGTGGGTGGTTTGTTAGAGGGAGA
GAGAGCGCATGAAACTGAAGAAGAGCAGAGGAGAGTACGGAGACAGGAAG
AGCATAGAGAGATGACCGAGGTGGAACATATGTTTGGGAAGGGGGAACTG
GAGGAGCAGAGGAAAAGAGAAGAGAATCGTGCGTTTGAGATTTCACGCAT
TCAGAAAGAGCAACATGAGAGGGTGATGTATGAGGAGCGAGTGAGAAGGG
AGGCGGCTGAACAGGAAGCAAGAGAGGTGGGACAATTAATTTATGAGAAG
CAAGAGGCTGAGCGGCTTCGTAAATCACAGGAAGAGCGGCGAATCCAGCT
TGATCTGGAGCTTCAACAAAAGCGCCGTGACGAGGAGGCGCTCGAACTTC
AACGGATCCAGCTCACCCTGGCTCGGGAGCGGGAAAACGAGACTATCCGA
CGCATTGAACAGGCAAGACAGGAAGAGATTGCCCGCAAAGAGCGTCTCG

Sequences in the Contig:

SY0AAB46YG13FM1