Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YG02FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00002619001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE66096.1| Score: 415 E_value: 4e-39
KEGG Definition: predicted protein
Accession: aor:AO090010000198 Score: 415 E_value: 2e-39
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O43070|NBS1_SCHPO
Gene Ontology:
GO:0030870 = Cellular component: Mre11 complex
GO:0005515 = Molecular function: protein binding
GO:0000724 = Biological process: double-strand break repair via homologous recombination
GO:0031573 = Biological process: intra-S DNA damage checkpoint
GO:0042138 = Biological process: meiotic DNA double-strand break formation
GO:0033127 = Biological process: regulation of histone phosphorylation
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAB46YG02FM1
TTGGCTTACACACTTCTATCCCTCCAGCATGTGGTTTATAGAGTGCGAAG
GTGAAGTTCTGGGTGGCAAGCGTCTCTGGCTTAGGCCAAACCAAAGATTC
GCTATCGGACGAACGCCCTCTCAGGATGTTAATTTGTCGCTTCCATCGCA
AAAGTCCATCTCACGAATACACCTCCTGATTGAAGTTGGGGACGTAAAAG
AAGGTGACGGGCTTAAGCTAAACGTTCGCCCAAGCCTGAAGGTTCAGGAT
CACAAAACAAAGCACGGGACAAGGATTGATGGACAAGAAATTCGTGATCA
AATGGTCACCCTTGACGAAGAATCATATTCTATCCACCTTGGAAAATATG
AACCAACCTTCAGACTATATTGGGACCCAATTGTCTTCTCGGTGTCGCTC
TCCTCAAAGGATAGAAAGGACAAAAGGAGTATGATTCCATACCAGAATAA
AGTTGAGGCTCTTGGTATCAAGACCTTAGCTACCTTCGTTCCTTCTACTA
CGCACGTTGTTGCATCAAAGCGCAATACGGCCATAGGCCTGCAGGCACTT
ATCAATGGCAAATTTATAGTGACAAGCTCCTATCTCGACGCAGTTGCTCA
GGCCGCTAGTGTGCCCCCG

Sequences in the Contig:

SY0AAB46YG02FM1