Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YE04FM1
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00005420001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: mannose-6-phosphate isomerase
Accession: ref|XP_957390.1| Score: 665 E_value: 5e-68
KEGG Definition: hypothetical protein
Accession: ncr:NCU07165.1 Score: 665 E_value: 2e-68
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2757 Score: 642 E_value: 6e-68
PFAM Definition: PMI_typeI, Phosphomannose isomerase type I..
Pfam Number: pfam01238 Score: 550 E_value: 3e-57
Swissprot: Q870Y1|MANA_NEUCR

Sequence:
>SY0AAB46YE04FM1
TTGGGACAAAAGTCTTTTCTTCTGATTTCCTTTTTCTCTCTGGGCATCAG
GAGTATCTTCATATATTTATCACTCTACAATTGGCTATTTCACAGCAATC
ACCCAAAATGCTTCCAGTCCCACTTATCCAGCTTCAATGCGGTGCAAATT
CTTATGATTGGGGAAAGATAGGAAACGATTCTGCAGCCGCTCGTTTTGCC
GCTGCAACTACTCAATCCGGCTTCAAGATTGAGGAATCAAAGCCTTATGC
TGAGCTCTGGATGGGAACTCATCCATCAAACCCATCCAAGGATGTGGACA
CTGGGCGTACCCTCCTAGAGCTTGTCAATAGCAATACAGCCCTCCTCTCT
CACGATATTGCAGAAAAATACGGGGGAAAACTACCCTTCCTTTTCAAAAT
TCTATCGATCCAGAAGGCTCTCAGCATCCAGGCCCACCCTGACAAGAAGC
TTGCCGAAAGACTACATAGCGAAGACCCGAAGAACTACCCTGATGACAAC
CACAAACCTGAGATGGCCATTGCCGTCACTCCCTTTGATGGGTTTTGTGG
GTTTCGCCCTCTTTCCGAAATTGTTTCCTTCTTGGAATCGACCCCACCAC
TTCGTGCACTCGTTGGCGAATCCAAGTCGGATATTTTTATTGCTGCTGTT
GGGGACAAGGCAGATGCTAGTGACGAG

Sequences in the Contig:

SY0AAB46YE04FM1