Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YD23FM1
Length(NT) : 408
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 420 E_value: 5e-40
KEGG Definition: hypothetical protein
Accession: ani:AN8541.2 Score: 342 E_value: 2e-31
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 174 E_value: 5e-14
PFAM Definition: No Hit Found
Swissprot: Q05090|KLC_STRPU

Sequence:
>SY0AAB46YD23FM1
TTGGAGATCACAAAGATACTTTAAGGAGTGTTGATAACCTCGGTACAGCT
CTGCATTGACAGGGAAAGTACCACGAAGCCGAGATAATGCATCGACGTGC
AGTGGTGGGCAGAGAGAGGATTCTAGGGCTAGAGCATCGGGATACCTTAG
GGAGTGTCAGCAATCTCGGTAAAACTCTTCACCGGCAAGGAAAGTACAGC
GAAGCCAGGATTATGCATCGACGTGCGTTGGAGGGCAGAGAGGGGATCCT
GGGGCCGGATCATCGGGACACCTTAGACAGTGTTCATAATCTTGGCACAA
CTCTCCATTGTCAGGAAGAGTACGGTGAAGCCGAGATTCTGCATCAACGT
GCATTATCAGGTAGAGAAAAAACACTGGGGCTTGATCATCACGAAACACT
TCTAAGCG

Sequences in the Contig:

SY0AAB46YD23FM1