Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YC21FM1
Length(NT) : 535
Best Gene Model Blast : Link to GSTUMT00006597001 E-value : 1e-144
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 458 E_value: 3e-44
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 416 E_value: 1e-39
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 252 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB46YC21FM1
TTGGGGTGTAGTCAAGCTACTTCTTGCACGTGGGGATGTCAATGCCGATT
CAGCAGATAATGTTGGACTAACACCACTATCATATGCCGCGGGGTCTGGG
TGTGTGGGTGTTGTCAGGCTGCTTCTTGAGCGCGGGAATGTCAACCCTAA
TTTAGCTGATAATGGTGGACGAACACCACTGTCATATGCCGCGGAGTGTG
GGAGTAAAGGTGTAGTCAACCTACTTCTTGAGTATGGGGATGTCGATGCC
TATTTAGCAGATAATGGTGGACGAACACCACTATCGTATGCCGCGGGGTC
TTGGAGTGAAGGTGTAGTCAAGCTACTTCTTGAGCGTGGGAATGTCGATA
CCGATTTAACAGATAAAGCTGGGCGAACACCACTATCATATGCCGCGGAG
TCTGGGCGTGAAGGTGTAGTCAAGCTACTTCTTGAGCACGGGGATGTCAA
TACCCATTTATCAGATATCGATGGACGAACACCACTATCATATGCCGTGG
GGTCTTGGAGTGAAGGCGTAGTCAAGCTATTTCTT

Sequences in the Contig:

SY0AAB46YC21FM1