Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB46YB19FM1
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00007114001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55189.1| Score: 369 E_value: 9e-34
KEGG Definition: cell division control protein/predicted DNA repair exonuclease
Accession: aor:AO090005000073 Score: 369 E_value: 5e-34
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3662 Score: 316 E_value: 3e-30
PFAM Definition: No Hit Found
Swissprot: P40986|CDC1_YEAST
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0030036 = Biological process: actin cytoskeleton organization and biogenesis
GO:0030026 = Biological process: cellular manganese ion homeostasis
GO:0006281 = Biological process: DNA repair

Sequence:
>SY0AAB46YB19FM1
TTGGTATTTTATACGGATCAGTACATGTCACGGTCGTACGAGACTATCCA
GGAGCGGCTTTCTCCTTCCACGACGGTATTCCTGGGTGATTTATTCGACG
GCGGGCGGGAATGGACACACGAGCAGAGCTCGCGCTATGCCCAAAATCAC
CACCTACACGAGGACTTGATTCCTATTACGGAAGACCCACGAGGGGCGAA
GGATTGGAAGGACTATGGTGATAGCTACTGGATGGGCGAGTACAGGCGGT
TTTTGAAGATTTTCCCCAGTTGGCCTTACCGAAGGACTGTCAAAACACTG
CCGGGGAACCACGACTTTGGTATGGGAAACGGTATTCGAGAGGGGGTGAA
GGATAGGTTCAGAACTTACTTTGGCGAGACGAGCGGGGTATTGGAAGCAG
GCAATCACACTATCGTACTAATTGACTCTGTCTCTTTATCGAACGATAAC
AATCCAAAGATCTACCTACCAGCCCGAGACTTCCTCGATAGCCTCCCAGA
TCTCCTAACAACACCATCACCAACCCTCCTCCCGCACGTCATTGAGGAAG
CAGCAAATCCCCTTTCCTCGCCCTCAGGTCAAGATTCCATCCCTCAAAAC
CCTACAATACTCCTCACCCACGTCCCCTTATACCGGCCCGCCGACACCCC
CTGCGGCCCGC

Sequences in the Contig:

SY0AAB46YB19FM1